C. Results: The most effective crRNA sequence inducing a robust cleavage effect on S and a potent collateral cleavage effect were identified. Conclusions: This study provides a rapid design pipeline for a CRISPR-Cas13a-based antiviral tool against SARS-CoV-2. Moreover, it offers a novel approach for anti-virus study even if the precise structures of viral proteins are indeterminate. evaluation was performed to screen potential optimal crRNA candidates. The S RNA knockdown efficiency and collateral cleavage effect were examined in HepG2 and AT2 cells to identify an optimal crRNA. Identification of a unique sequence segment in SARS-CoV-2 S receptor-binding domain (RBD) Gene sequence alignment revealed a higher sequence identity (76-78%) of SARS-CoV S with SARS-CoV-2 S than with MERS-CoV S (29-30%). Similar to SARS-CoV S and MERS-CoV S, SARS-CoV-2 S is composed of two subunits, S1 and S2, (Figure ?Figure22A), which may Rabbit Polyclonal to OR8K3 be responsible for host-receptor binding and membrane fusion, respectively. The -strand-rich S1 subunit consists of an N-terminal domain (NTD), linker region (L), receptor-binding domain (RBD), and subdomain (SD). The -helix-rich S2 subunit consists of an upstream helix (UH), fusion peptide (FP), connecting region (CR), heptad repeat (HR), central helix (CH), -hairpin (BH), transmembrane domain (TM), and a cytoplasmic domain (CP) (Figure ?Figure22A). The S1 RBDs of SARS-CoV and SARS-CoV-2 mediate viral binding to the host receptor ACE2. Open in Tenofovir (Viread) a separate window Figure 2 Identification of a unique segment in the SARS-CoV-2 S RBD. A. Schematic diagram of the protein domains of SARS-CoV-2 S. The RBD, comprising residues 339-592 of the S1 subunit, is a key region mediating virus-cell receptor interaction. B. Sequence alignment of SARS-CoV-2 RBD and SARS-CoV RBD revealed two segments with numerous residue differences. C. 3D-structural superimposition revealed the high structural homology between SARS-CoV-2 S and Tenofovir (Viread) SARS-CoV S. D. Further structural comparison of SARS-CoV-2 RBD and SARS-CoV RBD revealed a more obvious structural difference in segment 2 than in segment 1. E. Sequence alignment of SARS-CoV-2 RBD and MERS-CoV RBD revealed low sequence similarity throughout the RBD region, including segment 2. F. 3D-structural superimposition revealed low structural homology between SARS-CoV-2 S and MERS-CoV S, particularly in the RBD region. To identify unique sequences in the SARS-CoV-2 S RBD unique from your SARS-CoV and MERS-CoV S RBDs, sequence alignment, and 3D-structural superimposition analysis were performed. Despite the high similarity of the SARS-CoV-2 and SARS-CoV S RBDs, we found many sequence variations and structural variations in their interfaces with ACE2. First, based on amino acid sequence Tenofovir (Viread) alignment with the SARS-CoV S RBD, we recognized two unique segments in the SARS-CoV-2 S RBD. Section 1 (residues 447-469, Tenofovir (Viread) mRNA: AGAUUGUUAGAACUAAGAUUCCAACCACCAUUAAUAUUAAUGGACAUAUCUAACAAAUCCUUCAGAUUA) and section 2 (residues 479-503, mRNA: UGACUUUAGAUAGUCCGGCCAUCGUGUGGAACAUUACCACAACUUCCAAAAUUAACAAUGAAAGGAAAUGUUAGU) of the SARS-CoV-2 RBD greatly differed in sequence from the related segments in the SARS-CoV RBD (Number ?Number22B), supporting potential unique functions. Second, the structural superimposition analysis exposed high structural homology between the S proteins of SARS-CoV-2 and SARS-CoV. However, the structural variations were evident in their RBDs (Number ?Number22C). The RBD region was enlarged to analyze the constructions of segments 1 and 2 (Number ?Number22D). Section 1 located in the telechelic structure of SARS-CoV-2 S was a long loop, whereas in SARS-CoV S, it contained small helices. The flexibility of the loop structure facilitates binding to ACE2 (Number ?Number22D). Section 2 forming a long flexible loop structure is definitely a key region for acknowledgement and binding of ACE2. The high flexibility of section 2 allows for great structural variance. Section 2 in SARS-CoV-2 RBD is definitely a more compact structure than the related section in SARS-CoV RBD (Number ?Number22D). Given the greater structural variance in section 2, this section was selected as the specific target sequence for SARS-CoV-2. Sequence positioning and structural analysis of SARS-CoV-2 S and MERS-CoV S exposed very low sequence identity and structural homology, especially in the RBD region (Number ?Number22E-F). Section 2 of.